Translate

Κυριακή 6 Οκτωβρίου 2019

Epigenetic silencing of microRNA-335 contributes to nasopharyngeal carcinoma metastasis

Under a Creative Commons license
open access

Abstract

Background

MircoRNA-335 (miR-335), a member of mircoRNAs (miRNAs) family, has been found to be correlated with tumor invasion and metastasis. In this study, we aimed to detect the effect of miR-335 methylation on metastasis of nasopharyngeal carcinoma.

Methods

RT-PCR and methylation-specific PCR were applied to detect the expression levels of miR-335 and miR-335 methylation in nasopharyngeal carcinoma tissues.

Results

The levels of miR-335 expression were significantly lower in nasopharyngeal cancer tissues with promoter methylation, compared to those with promoter unmethylation. The levels of miR-335 gene promoter methylation were higher in 14 (46.7%) out of 30 nasopharyngeal cancer tissues. Furthermore, the patients with cervical lymph node metastasis had higher methylation rate in miR-335 promoter (66.7% versus 16.7%) than those without cervical lymph node metastasis.

Conclusion

Gene methylation contributes the expression of miR-335 in nasopharyngeal carcinoma. The expression of miR-335 methylation is correlated with the metastasis of nasopharyngeal carcinoma.

Keywords

miR-335
Nasopharyngeal carcinoma
Methylation
Metastasis

1. Background

MicroRNAs (miRNAs) are a class of recently discovered small RNA molecules that regulate the expression of genes at the translational level. MiRNAs are endogenously expressed short non-coding RNAs with 18–25 nucleotides in length capable of repressing protein translation through binding to target messenger RNA [1,2]. It has been reported that miRNAs are associated with cancer's development, progression and treatment [3]. Dysregulation of miRNAs in cancer contribute to the multistep process of carcinogenesis either as oncogenes or tumor suppressor genes [4,5].
Epigenetic is a way of genetic inheritance. It refers to the mechanisms that regulate gene expression without altering the primary DNA sequence. Epigenetics includes DNA methylation, histone modification, chromatin remodeling, and noncoding RNAs [6]. DNA methylation is one kind of DNA covalent modification. This modification has essential regulatory effects on gene expression, especially when modification happens in CpG-rich areas known as “CpGislands” [7] located in the promoter regions of many genes. Transcriptional silencing by hypermethylation of CpG islands in the promoter region is gradually recognized as a common mechanism for the inactivation of tumor suppressor genes [8,9]. In some studies, promoters hypermethylation of cancer-related genes were frequently found in a variety of human cancers [10,11]. MiRNAs whose permanent expression is silenced by DNA methylation have been reported in a few human cancers [12,13].
Nasopharyngeal carcinoma (NPC) is a frequent malignant neoplasm in southern China. Its etiopathogenesis is not clear, which may be caused by a variety of factors. In the present study, we aimed to demonstrate a link between the methylation status of miR-335 and the metastasis of nasopharyngeal carcinoma.

2. Material and methods

2.1. Subjects

Thirty cases of nasopharyngeal carcinoma were included in the study. All biopsies were obtained from patients with nasopharyngeal carcinoma who had given their consent before treatment at the Department of Otolaryngology in our Hospital. All specimens were subjected to histological diagnosis by a pathologist according to TNM stage classification (UICC 2002).

2.2. Methylation-specific PCR (MSP)

Nasopharyngeal cancer cell genomic DNA was extracted using the DNeasy tissue kit and was modified using the Zymo golden methylation kit (Zymo, Orange, CA) following the manufacturer's instructions. Methylation-specific PCR was utilized to amplify the indicated region of miR-335 gene. The methylated primer: forward F: TTTGTATTGTGATTTTATTTTACGT, R: AACAAATTTCCTTTACAACAACG. The unmethylated primer: forward F: TTTGTATTGTGATTTTATTTTATGT, R: AAACAAA TTTCCTTTACAACAACAC. The above miR-335 promoter using Platinum Taq DNA polymerase (Invitrogen) according to the manufacturer's recommendations under the following same cycle conditions: 95°Cfor 3 min; 10 cycles of 95 °C for 30 s, 52 °C for 30 s and 72 °C for 45 s; 20 cycles of 95 °C for 30 s, 50 °C for 30 s and 72 °C for 45 s; a final extension of 72 °C for 5 min. The amplified products were fractionated on 2% agarose gels.

2.3. Reverse transcription-PCR (PT-PCR)

Total RNA was isolated from nasopharyngeal cancer cells using Trizol regents. It was used for reverse transcription and amplification. The following primers were used for RT-PCR. The miR-335 primer: TCAAGAGCAATAACGAAAAATGT (follower), GCTGTCAA CGATACGCTACGT (reverse).The U6 primer: CTCGCTTCGGCAGCACA (forward), AACGCTTCACGAATTTGCGT (reverse). The DNA was amplified under the following conditions: 95 °C for 3 min, 30 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s, and a final extension at 72 °C for 5 min. The PCR products were then analyzed on a 1% agarose gel.

2.4. Statistical analysis

All data were analyzed by the SPSS 17.0 statistical software for windows. Categorical variables were expressed as frequencies and percentages, and analyzed with Pearson χ2 test. P values <0.05 were considered significant difference.

3. Results

3.1. Patient demographics

Of all the patients, 8 patients were stage I (26.3%), 11 patients were stage II (28.9%), 7 patients were stage III (31.6%), and 4 patients were stage IV (13.2%). And 18 patients had cervical lymph node metastasis, 12 patients had no cervical lymph node metastasis.

3.2. Methylation status of miR-335 gene in the nasopharyngeal cancer

Methylation of miR-335 gene promoter was found in 14 (46.7%) out of 30 nasopharyngeal cancer tissues (Fig. 1). There was no significant difference in promoter methylation rate among samples from patients with different TNM stages (χ2 = 3.106, P = 0.124). In contrast, the specimens from patients with cervical lymph node metastasis (12/18, 66.7%) had higher methylation rate in miR-335 promoter than those without cervical lymph node metastasis (2/12, 16.7%) (χ2 = 13.368, P < 0.001).
Fig. 1
Fig. 1. Methylation status of miR-335 gene in the nasopharyngeal cancer. PC: Positive control (completely methylation), NC: negative control (completely unmethylation); Lane M, amplified product with primers recognizing methylated sequences; Lane U, amplified product with primers recognizing unmethylated sequences; 1–30 represent tissues samples of nasopharyngeal cancer.

3.3. miR-335 mRNA expression in the nasopharyngeal cancer

Nasopharyngeal cancer tissues with promoter methylation showed significantly lower expressions or no expression of miR-335. However, nasopharyngeal cancer tissues with promoter unmethylation had higher expressions of miR-335 mRNA (Fig 2, Fig 3). Furthermore, no expression of miR-335 was found in 10 out of 12 nasopharyngeal cancer tissues from patients with cervical lymph node metastasis,lower expressions of miR-335 was found in the else two nasopharyngeal cancer tissues from patients with cervical lymph node metastasis.
Fig 2
Fig 2. Analysis of miR-335 gene expression in the nasopharyngeal cancer tissues. PC: positive control, H2O: negative control, 1–30 represent tissues sample of nasopharyngeal cancer.
Fig 3
Fig 3. Analysis of U6 gene expression in the nasopharyngeal cancer tissues. PC: Positive control, H2O represent negative control,1–30 represent tissues sample of nasopharyngeal cancer.

4. Discussion

In recent years, miRNAs have been found to be vital to many normal cellular processes, such as proliferation, development, differentiation, and apoptosis. They can regulate the expression of target gene through imperfect pairing with target mRNAs of protein-coding genes, inducing direct mRNA degradation or translational inhibition [17,18]. Down-regulation of miRNAs has been observed in various types of human cancer [19]. miR-335 is transcribed from the genomic region on chromosome 7q32.2 [20]. It has demonstrated different functions as an oncogenic or a tumor-suppressor miRNA in various human malignancies. For instance, it was upregulated in meningioma and myeloma [21,22], but downregulated in breast cancer [23]and pancreatic adenocarcinoma [24].
Dohi et al., has identified DNA hypermethylation, illustrating low expression of miR-335 aberrant DNA methylation by in hepatocellular carcinoma [16]. In the present study, low levels or none of miR-335 were found in nasopharyngeal cancer tissues with miR-335 gene promoter methylation, but high expression of miR-335 in nasopharyngeal cancer tissues with miR-335 gene promoter unmethylation. These results indicated that promoter methylation may be involved in the regulation of miR-335 expression. Png et al. also revealed the epigenetic mechanisms which resulted in the low expression of miR-335 in breast cancer by aberrant DNA methylation [15].
Tavazoie et al. reported miR-335 as metastasis suppressor genes. They found that restoring the expression of miR-335 in malignant breast cancer cells can restrain the metastasis in lung and bone [14]. In the present study, miR-335 gene promoter hypermethylation were found in 12 out of 18 cases where nasopharyngeal cancer tissues have cervical lymph node metastasis. Only 2 cases of miR-335 gene promoter hypermethylation were found in 12 nasopharyngeal cancer tissues without cervical lymph node metastasis. Clinically, miR-335 expression and miR-335 gene promoter methylation is related to cervical lymph node metastasis in the patients with nasopharyngeal cancer. One might speculate that miR-335 gene promoter hypermethylation contribute the metastasis of nasopharyngeal cancer.

5. Conclusions

Gene methylation contributes the expression of miR-335 in nasopharyngeal carcinoma. The expression of miR-335 methylation is correlated with the metastasis of nasopharyngeal carcinoma. Further work will be aimed at elucidating the role of miR-335 in the metastasis of nasopharyngeal cancer.

Abbreviations

miR-335
mircoRNA-335
PT-PCR
reverse transcription-PCR
NPC
nasopharyngeal carcinoma
mRNA
messenger RNA

Ethics approval and consent to participate

Ethics committee of Guang Ming New District People's Hospital of Shen Zhen approved the study. The reference number is 20150902.

Consent for publication

The patient provided written informed consent for the publication of any associated data.

Funding

This project was supported by Shenzhen Science and Technology Innovation Council medical research funding program (series numbers JCYJ20150402161136231 and 201302227).

Authors' contributions

Song Zhang designed the study and supervised all experiments. Ju-Hong Yang executed RT-PCR and methylation-specific -PCR experiments, and drafted this paper. Lie-Kun Lin executed DNA and RNA extract experiments. All authors read and approved the final manuscript.

Declaration of competing interest

The authors declare they have no competing interests.

Acknowledgements

Not applicable.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

View Abstract

Δεν υπάρχουν σχόλια:

Δημοσίευση σχολίου

Αρχειοθήκη ιστολογίου

Translate